
Проблемы Эндокринологии

Расширенный поиск

Фенокопии синдрома множественных эндокринных неоплазий 1 типа: роль генов, ассоциированных с развитием аденом гипофиза

Полный текст:


Актуальность. Отсутствие мутации в гене MEN1 у пациента с фенотипом синдрома множественных эндокринных неоплазий 1-го типа (МЭН-1) может опровергнуть наследственную природу заболевания, и соответственно необходимость пожизненного регулярного скрининга для выявления оставшихся компонентов синдрома, а также обследование родственников первой линии родства. Однако не исключено существование других генов, вовлеченных в сочетанное развитие нескольких компонентов синдрома МЭН-1. 

Цель исследования — определить роль генов, ассоциированных с развитием наследственных аденом гипофиза (АГ), а также генов, возможно вовлеченных в патогенез спорадических АГ, в развитии фенокопий синдрома МЭН-1, одним из компонентов которых является АГ.

Материал и методы. В исследование включены 23 пациента с фенокопиями МЭН-1. Пациентам проведено высокопроизводительное параллельное секвенирование (next-generation sequencing — NGS) (Ion TorrentTM PGMTM, Thermo Fisher Scientific — Life Technologies, США) панели генов-кандидатов (MEN1, CDKN1B, PRKAR1A, AIP, SDHA, SDHB, SDHC, SDHD, GNAS, PRKCA, CDKN2A, CDKN2C, POU1F1, PTTG2). 

Результаты. У 1 (4%) пациентки с акромегалией и первичным гиперпаратиреозом (ПГПТ) выявлена герминальная гетерозиготная замена в экзоне 6 гена AIP c.911G>A (p.R304Q). У 4 пациенток с акромегалией и ПГПТ были выявлены полиморфизмы, патологическая значимость которых не определена: гетерозиготная замена в экзоне 1 гена PTTG2 c.134G>A (p.R45H), гетерозиготная замена в интроне 1 гена PRKAR1A (c.–10G>C), гетерозиготная замена в экзоне 5 гена SDHB c.487T>C (p.S163P), гетерозиготная замена в 3’-UTR гена CDKN1B g.3897G>T (c*8G>T).

Заключение. Согласно результатам нашего исследования, мутации в большинстве известных генов, ассоциированных с развитием наследственных и спорадических АГ, не обусловливают фенокопии синдрома МЭН-1. Необходимость прицельного исследования гена AIP у всех пациентов с фенокопиями синдрома МЭН-1 требует дальнейшей оценки. Также рекомендуется поиск новых генов, мутации в которых могли бы быть причиной развития фенокопий синдрома МЭН-1.

Для цитирования:

Мамедова Е.О., Мокрышева Н.Г., Пигарова Е.А., Пржиялковская Е.Г., Васильев Е.В., Петров В.М., Дзеранова Л.К., Молитвословова Н.Н., Рожинская Л.Я., Тюльпаков А.Н., Мельниченко Г.А. Фенокопии синдрома множественных эндокринных неоплазий 1 типа: роль генов, ассоциированных с развитием аденом гипофиза. Проблемы Эндокринологии. 2016;62(4):4-10.

For citation:

Mamedova E.O., Mokrysheva N.G., Pigarova E.A., Przhiyalkovskaya E.G., Vasilyev E.V., Petrov V.M., Dzeranova L.K., Molitvoslovova N.N., Rozhinskaya L.Y., Tiulpakov A.N., Melnichenko G.A. Phenocopies of multiple endocrine neoplasia type 1: role of the genes, associated with the development of pituitary adenomas. Problems of Endocrinology. 2016;62(4):4-10. (In Russ.)


Синдром множественных эндокринных неоплазий 1-го типа (МЭН-1), проявляющийся сочетанным развитием первичного гиперпаратиреоза (ПГПТ), аденом гипофиза (АГ) и нейроэндокринных опухолей поджелудочной железы (НЭО ПЖ), возникает в результате герминальных мутаций в гене-супрессоре опухолевого роста MEN1. Клинический диагноз синдрома основывается на сочетании минимум двух из трех вышеперечисленных опухолей и должен быть подтвержден результатами молекулярно-генетического исследования [1].

В 10—30% семейных случаев МЭН-1 и до 90% спорадических случаев этого синдрома мутации в гене MEN1 методом прямого секвенирования по Сэнгеру не выявляются [2]. Синдром МЭН-1, диагностированный по клиническим признакам, но без выявленной мутации в гене MEN1, обозначается как фенокопия синдрома МЭН-1 [3—5]. Таким образом, с помощью молекулярно-генетического исследования можно подтвердить диагноз фенокопии синдрома МЭН-1 у пациента. В соответствии с существующими международными рекомендациями, отсутствие мутации в гене MEN1 исключает необходимость ежегодного скрининга с целью раннего выявления оставшихся компонентов синдрома у пациента и риск заболевания у родственников первой линии родства [1]. Однако могут иметь место мутации в некодирующих областях гена MEN1, крупные делеции гена или мутации в других, еще не установленных, генах [1].

Примерно в половине спорадических случаев МЭН-1 наблюдается сочетание АГ и ПГПТ; частота герминальных мутаций в гене MEN1 при таком сочетании в среднем составляет около 7%, что значительно ниже, чем при семейном МЭН-1 [2]. Примечательно, что у фенокопий МЭН-1 с сочетанием АГ и ПГПТ в подавляющем большинстве случаев встречаются соматотропиномы, а не пролактиномы, как при истинном МЭН-1 с мутацией в гене MEN1 [2, 6]. Кроме того, пациенты с фенокопиями МЭН-1 обычно старше пациентов с истинным МЭН-1 [2, 6]. При спорадическом сочетании АГ и НЭО ПЖ частота герминальных мутаций в гене MEN1 также составляет около 7% [2].

Механизмы возникновения фенокопий МЭН-1 изучены недостаточно. Сочетанное развитие АГ и ПГПТ (и/или НЭО ПЖ) может объясняться следующими причинами: 1) мутациями в генах (возможно, еще неизученных), приводящими к одновременному развитию АГ и ПГПТ (и/или НЭО ПЖ); 
2) мутациями в генах, приводящими к семейным формам АГ, при сочетании со спорадическим ПГПТ (и/или НЭО ПЖ) или мутациями в генах, приводящими к семейным формам ПГПТ, при сочетании со спорадическими АГ (и/или НЭО ПЖ); 3) бигенным заболеванием, когда у одного и того же пациента или одной семьи имеются мутации в двух генах, приводящие к развитию семейных форм АГ и семейных форм ПГПТ; 4) развитием АГ и ПГПТ (и/или НЭО ПЖ) у одного и того же пациента вследствие случайного спорадического сочетания. Исключение наследственной природы сочетания нескольких эндокринных неоплазий крайне важно для определения тактики ведения пациента и обследования родственников первой линии родства.

Цель исследования — определить роль генов, ассоциированных с развитием наследственных АГ, а также генов, возможно вовлеченных в патогенез спорадических АГ, в развитии фенокопий синдрома МЭН-1, одним из компонентов которых является АГ.

Материал и методы

В исследование были включены 23 пациента с клиническим диагнозом синдрома МЭН-1, наблюдавшихся в отделении нейроэндокринологии и остеопатий ФГБУ «Эндокринологический научный центр» Минздрава России. С учетом цели исследования, одним из компонентов синдрома МЭН-1 у 22 пациентов была АГ. В исследование была включена также 1 пациентка с краниофарингиомой, что обосновывалось наличием у нее двух других компонентов синдрома МЭН-1 (ПГПТ и НЭО ПЖ), а также особенностью эмбрионального развития краниофарингиомы из клеток-предшественников аденогипофиза. Кроме того, у 1 пациентки имело место не классическое для МЭН-1 сочетание опухолей, а сочетание АГ и феохромоцитомы. Диагнозы АГ, ПГПТ и НЭО ПЖ установливались в соответствии со стандартными алгоритмами [1]. Во всех случаях отсутствовали надежные данные о наличии АГ, ПГПТ, НЭО ПЖ или синдрома МЭН-1 у родственников первой линии родства. Критерием исключения являлись выявленные ранее секвенированием по Сэнгеру мутации в гене MEN1. Все пациенты подписывали информированное согласие на участие в исследовании.

Молекулярно-генетическое исследование

Всем пациентам было проведено исследование панели генов-кандидатов, включающей гены, герминальные мутации в которых могут приводить к развитию наследственных АГ (MEN1, CDKN1B, PRKAR1A, AIP); гены, мутации в которых могут приводить к сочетанному образованию АГ и феохромоцитом/параганглиом (SDHA, SDHB, SDHC, SDHD), а также некоторые гены, в которых были выявлены соматические мутации, или изменение экспрессии которых было зафиксировано в тканях спорадических АГ (GNAS, PRKCA, CDKN2A, CDKN2C, POU1F1, PTTG2) [7]. Панель праймеров для мультиплексной амплификации вышеперечисленных генов (207 ампликонов) была создана с помощью программы Ion AmpliSeqTM Designer ( Геномная ДНК была выделена из цельной крови с использованием набора MagNA Pure LC DNA Isolation Kit I (Roche Diagnostics, Швейцария) с помощью MagNA Pure LC 2.0 Instrument («Roche Diagnostics», Швейцария). В дальнейшем были проведены этапы подготовки проб перед высокопроизводительным параллельным секвенированием (next-generation sequencing — NGS) и собственно NGS на секвенаторе Ion TorrentTM PGMTM (Thermo Fisher Scientific — Life Technologies, США) в соответствии со стандартными протоколами (доступны на сайте или по запросу). Анализ данных NGS проводился с помощью программного обеспечения Torrent SuiteTM (Thermo Fisher Scientific — Life Technologies, США). Аннотирование выявленных изменений проводилось с помощью программы ANNOVAR ( [8]. В качестве референсной последовательности генов MEN1, CDKN1B, PRKAR1A, AIP, SDHA, SDHB, SDHC, SDHD, GNAS, PRKCA, CDKN2A, CDKN2C, POU1F1, PTTG2 использовалась ссылка Genbank ( под номерами NM_130799.2NM_004064.4NM_002734.4NM_003977.3NM_004168.3NM_003000.2NM_003001.3NM_003002.3NM_000516.4NM_002737.2NM_000077.4, NM_001262.2, NM_000306.3, NM_006607 соответственно.


Клинические характеристики пациентов представлены в таблице. Среди пациентов преобладали женщины (соотношение 10:1). У большинства пациентов (n=20) имелось сочетание АГ и ПГПТ, у 1 пациентки (№23) — сочетание краниофарингиомы, ПГПТ и НЭО ПЖ, у 1 пациента (№14) — АГ и НЭО ПЖ, у 1 пациентки (№22) — АГ и феохромоцитомы правого надпочечника.

Клиническая характеристика пациентов с фенокопиями синдрома МЭН-1






СТГ; микро (э); МР (АС+АД); 58

+; 53



СТГ; микро (э); МР (АС); 46

+; 52



СТГ; микро (э); Р (ТТА); 58

+; 56



СТГ; микро (э); МР (АС); 61

+; 65



СТГ; микро (э); МР (АС); 21

+; 69



СТГ; микро (э); МР (АС); 43

+; 61



СТГ; макро (э-п(S)-р); НР (ТТА); 40

+; 57



СТГ; макро (э-п(D); МР (АС)+ТТА+ ЛТ; 29

+; 53



СТГ; макро (э); Р (ГТ + ТТА); 48

+; 63



СТГ; макро (э-п(S)-и); НР (2 ТТА+АС+АД); 46

+; 54



СТГ; макро (э-c-п(D)-и); НР (АС), пока НО; 41

+; 51



СТГ; макро (э-с-п(D)-а); НР (ТТА); 48

+; 67



СТГ; макро (э); НР (АС); 59

+; 25 (57)°



СТГ; макро (э-п(D)-и); НР (ТТА); 76



СТГ; макро (э-и); НР (ТТА); 30

+; 64



СТГ; макро (э-п(D)-и); НР (АС+АД); 57

+; 72



ПРЛ; макро; Р (АД+ТТА+ТКА+ГТ); 22

+; 59



АКТГ; микро (э); НР (2 ТТА); 45

+; 54



АКТГ; без визуализации; Р (ТТА); 58

+; 60



ГНАГ; макро (э-п(S)-и); НО; 49

+; 54



СТГ+ПРЛ; макро (э-с-п(S)); МР (АС+АД); 45

+; 56



СТГ+ПРЛ; микро (э); НО, назначены АС; 40



Краниофарингиома; макро (э-интравентрикулярная); Р (ТСА); 47

+; 43

Примечание. *Указаны: тип секреции; размер и характер роста; наличие ремиссии; возраст на момент дебюта/выявления (годы). ** Указаны: наличие (+ есть, – нет); возраст на момент дебюта/выявления (годы). ^ Пациенты с НЭО ПЖ. ~ Пациентка с феохромоцитомой правого надпочечника. ° См. объяснение в тексте.

Сокращения: СТГ — соматотропный гормон; ПРЛ — пролактин; АКТГ — аденокортикотропный гормон; ГНАГ — гормональнонеактивная АГ; микро- — микроаденома; макро- — макроаденома; характер роста: (э) — эндоселлярный, (п) — параселлярный (D — в правый кавернозный синус, S — в левый кавернозный минус), (р) — ретроселлярный, (и) — инфраселлярный, (а) — антеселлярный; АС — аналоги соматостатина длительного действия; АД — агонисты дофамина; Р — ремиссия; МР — медикаментозная ремиссия; НР — нет ремиссии; ТТА — трансназальная транссфеноидальная аденомэктомия; ТКА — транскраниальная аденомэктомия; ГТ — гамма-терапия; ЛТ — лучевая терапия (Novalis); НО — не оперирован.

Аденомы гипофиза

Среди АГ преобладали соматотропиномы (n=16; 73%); остальные типы АГ были представлены единичными случаями: смешанная СТГ/ПРЛ-секретирующая АГ — 2 (9%), пролактинома — 1 (4,5%), кортикотропинома — 2 (9%), гормональнонеактивная АГ (ГНАГ) — 1 (4,5%). Информация о типе секреции, характере роста АГ, проведенном лечении, наличии ремиссии и возрасте дебюта АГ представлена в таблице. АГ были первым клиническим проявлением у 20 (91%) пациентов. У пациентки №23 первым клиническим проявлением была краниофарингиома. Дебютом заболевания считали возраст появления клинических признаков АГ или их выявления АГ (при отсутствии клинических признаков).

Первичный гиперпаратиреоз

ПГПТ был диагностирован у 21 из 23 пациентов на основании минимум двукратного определения повышенного уровня кальция и паратгормона (ПТГ) в крови. В большинстве случаев ПГПТ диагностировался позже АГ (90%). У 2 пациенток (№1 и №13) ПГПТ был выявлен раньше АГ (при обследовании по поводу мочекаменной болезни). У пациентки №13 мочекаменная болезнь дебютировала в 25 лет, однако диагноз ПГПТ был установлен лишь в возрасте 57 лет.

Нейроэндокринные опухоли поджелудочной железы

У 2 пациентов были клинически диагностированы гормональнонеактивные НЭО ПЖ. У пациентки №23 имелось сочетание краниофарингиомы, ПГПТ и НЭО ПЖ. С помощью мультиспиральной компьютерной томографии (МСКТ) в хвосте ПЖ было выявлено гиперваскуляризованное образование размером 1,3×1,2×1,5 см, в теле железы — гиперваскуляризованное образование размером 0,6×0,6×0,8 см (по характеристикам контрастного усиления, наиболее вероятно — НЭО). У пациента №7 при МСКТ в хвосте ПЖ было выявлено объемное образование низкой плотности диаметром 2,4 см, состоящее из мягкотканного и кистозного компонента. Была проведена корпорокаудальная резекция ПЖ (60%), спленэктомия, холецистэктомия (гистологически — серозная микрокистозная аденома диаметром 2 см и нейроэндокринная микроаденома диаметром 5 мм).

Феохромоцитома и другие опухоли

У пациентки №22, по данным МСКТ забрюшинного пространства, имелось объемное образование кистозно-солидной структуры правого надпочечника (3,2×3,3×3,6 см, плотность 36 НU) и образование левого надпочечника (0,86×0,87 см, плотность 11 НU). В моче выявлено повышение уровня метанефрина — 1647 мкг/сут (норма 25—312 мкг/сут), норметанефрина — 604 мкг/сут (норма 35—
445 мкг/сут), что подтверждало диагноз феохромоцитомы (вероятно, правого надпочечника, поскольку эта опухоль имела большие размеры и высокую плотность, тогда как образование левого надпочечника представляло собой скорее гормональнонеактивную опухоль). У некоторых пациентов имелись также другие эндокринные и неэндокринные новообразования: рак молочной железы (№1), рак почки (№12), злокачественная опухоль забрюшинного пространства (№20), гемангиома кожи стопы (№3), гемангиома тела поясничного позвонка (№17), липомы кожи (№14), опухоль яичника (№13), ангиолипома почки (№6), одно- и двусторонние гормональнонеактивные опухоли надпочечников (№2, 5, 6, 14, 17, 20), макронодулярная гиперплазия надпочечников (№11).

Молекулярно-генетическое исследование

По данным NGS, ни у одного из пациентов мутации в гене MEN1 выявлены не были, что подтверждает диагноз фенокопий синдрома МЭН-1. 
У 1 пациентки (№13) с макросоматотропиномой и висцеральной формой ПГПТ была выявлена герминальная гетерозиготная замена (миссенс-мутация) в экзоне 6 гена AIP c.911G>A (p.R304Q).

У 4 пациентов были выявлены полиморфизмы, патологическая значимость которых не определена: у пациентки №17 с макросоматотропиномой и костно-висцеральной формой ПГПТ — гетерозиготная замена p.R45H (c.134G>A) в экзоне 1 гена PTTG2, у пациентки №20 с ГНАГ и костно-висцеральной формой ПГПТ — гетерозиготная замена в интроне 1 гена PRKAR1A (c.-10G>C), у пациентки № 6 с микросоматотропиномой и мягкой формой ПГПТ — гетерозиготная замена в экзоне 5 гена SDHB p.S163P (c.487T>C), у пациентки №10 с макросоматотропиномой и мягкой формой ПГПТ — гетерозиготная замена в 3’-UTR генаCDKN1B g.3897G>T (c*8G>T).


АГ могут развиваться в рамках некоторых наследственных синдромов, к которым, помимо синдрома МЭН-1, относят синдром множественных эндокринных неоплазий 4-го типа (МЭН-4), Карни комплекс (CNC), семейные изолированные аденомы гипофиза (FIPA) [7, 9]. Указанные синдромы развиваются вследствие герминальных мутаций в генах CDKN1B, PRKAR1A и AIP соответственно [7, 9]. Следует отметить, что герминальные мутации в гене AIP выявляются только в 10% случаев FIPA, причина развития остальных FIPA до настоящего времени не установлена [10].

Синдромы семейных параганглиом/феохромоцитом типов 5, 4, 3 и 1 обусловлены мутациями в генах, кодирующих 4 субъединицы митохондриального комплекса сукцинатдегидрогеназы (SDHA, SDHB, SDHC и SDHD), соответственно. Показано, что мутации в этих генах иногда выявляются у пациентов с сочетанием АГ и параганглиом/феохромоцитом, что делает вероятным их участие в формировании АГ [11, 12]. В последнее время описано несколько пациентов с мутациями в гене рибонуклеазы — DICER1 (преимущественно дети с болезнью Кушинга вследствие бластом/аденом гипофиза, плевропульмональными бластомами и другими опухолями), однако роль таких мутаций в формировании АГ изучена мало [7, 9]. Подробное описание перечисленных наследственных синдромов выходит за рамки данной статьи; детальная информация представлена в ряде отечественных и зарубежных публикаций [7, 9—12].

При исследовании спорадических АГ были выявлены как соматические мутации в некоторых генах (GNAS, PRKCA, MEN1 и др.), так и изменения экспрессии ряда генов в ткани АГ (PRKCA, CDKN2A, CDKN2C, POU1F1 и др.), однако неясно являются ли они триггером образования АГ или возникают позднее уже в ткани АГ [7].

В нашем исследовании только у 1 (4%) из 23 пациентов с фенокопиями МЭН-1 была обнаружена герминальная гетерозиготная замена (возможно, миссенс-мутация) в гене AIP. Выявленная замена p.R304Q описана ранее у пациентки из Польши со спорадической кортикотропиномой, манифестировавшей в возрасте 26 лет [13]. Доказательство патогенности миссенс-мутаций всегда представляет трудности, однако выявленная нами мутация может считаться патогенной по нескольким алгоритмам in silico. Распространенность указанной мутации в популяции неизвестна. Примечательно, что в литературе была описана мутация со сдвигом рамки считывания в гене AIP (c.825_845delCGCGGCCGTGTGGAATGCCCA, p.His275GlnfsX49) у пациента с акромегалией, диагностированной в 23 года, и ПГПТ, диагностированным в 29 лет, по поводу которого было удалено солитарное образование околощитовидной железы [14]. Кроме того, описаны герминальные миссенс-мутации (возможно, полиморфизмы) в гене AIP у пациенток пожилого возраста со спорадическим ПГПТ без АГ [15]. Таким образом, выявленная нами гетерозиготная замена в гене AIP может рассматриваться либо как причина FIPA в сочетании со спорадическим ПГПТ, либо как причина и соматотропиномы и ПГПТ, либо как полиморфизм. В дальнейшем планируется обследование родственников первой линии родства пациентки №11 для выявления носителей мутации и определения их фенотипических проявлений.

Выявленная гетерозиготная замена p.R45H (c.134G>A) в экзоне 1 гена PTTG2 у пациентки №17 предсказана полиморфизмом по нескольким in silico алгоритмам. Кроме того, аргинин в положении 45 не является консервативным. Ген PTTG2 входит в семью генов PTTG (pituitary tumor transforming genes), включающую также гены PTTG1 и PTTG3, которые относятся к семейству секуринов, необходимых для регуляции расхождения сестринских хроматид во время митоза. Можно ожидать повышения экспрессии PTTG в опухолях различных типов. В ряде исследований установлено, что уровень мРНК PTTG в соматотропиномах выше, чем в ГНАГ, но в кортикотропиномах, пролактиномах и соматотропиномах статистически не различаются. Также показано, что экспрессия PTTG в гормональноактивных инвазивных АГ выше, чем в их неинвазивных аналогах [16]. Пациентка №17 характеризовалась рядом особенностей. Помимо АГ и ПГПТ, у нее имелись аденокарцинома правой почки и многоузловой токсический зоб, двусторонние гормональнонеактивные образования надпочечников, гемангиомы тела L3, кисты левой почки. В раннем послеоперационном периоде после трансназальной транссфеноидальной аденомэктомии, по поводу макросоматотропиномы, у нее развились клинические признаки надпочечниковой недостаточности (выраженная слабость, отсутствие аппетита, тошнота, рвота, гипотония); при этом в крови отмечалось парадоксальное повышение утреннего кортизола 
(> 1750 нмоль/л при норме 123—626 нмоль/л) и кортизола в вечерней слюне (121,9 нмоль/л; норма 0,5—9,4 нмоль/л) на фоне нормальной концентрации АКТГ (47,9 пг/мл), гипокалиемия (2,5 ммоль/л при норме 3,5—5,1 ммоль/л) и значительное снижение почечной функции (скорость клубочковой фильтрации — 30 мл/мин/1,73 м2). После внутримышечного введения препаратов глюкокортикоидов самочувствие пациентки значительно улучшилось.

В настоящее время описано около 10 сплайсинговых мутаций в гене PRKAR1A, преимущественно у пациентов с Карни комплексом, а также синдромом Кушинга вследствие первичной пигментной нодулярной гиперплазии коры надпочечников [17]. 
В нашем исследовании гетерозиготная замена в интроне 1 гена PRKAR1A (c.-10G>C) была выявлена у пациентки с гормональнонеактивной эндопараинфраселлярной макроаденомой гипофиза, костной формой ПГПТ и гормональнонеактивным образованием правого надпочечника. В анамнезе пациентки артериальная гипертензия кризового течения с 36 лет, объемное образование левого надпочечника, по поводу которого в возрасте 47 лет проведена левосторонняя адреналэктомия (гистологическое заключение: аденоматозная ткань, гормональные исследования перед операцией не проводились), а также злокачественная опухоль забрюшинного пространства, по поводу которой проведены экстирпация матки с правым придатком, экстирпация прямой кишки с забрюшинной опухолью (результаты гистологического заключения не предоставлены).

Гетерозиготная замена в гене SDHB p.S163P (c.487T>C), обнаруженная у пациентки с микросоматотропиномой и мягкой формой ПГПТ, встречается в европейской популяции с частотой 1,7%. Такая замена описана как полиморфизм у пациента с медуллярным раком щитовидной железы [18]. Герминальные мутации в гене SDHB приводят к развитию синдрома семейных параганглиом/феохромоцитом типа 4. К 2015 г. описано 6 пациентов с мутациями в гене SDHB, у которых АГ сочетались с феохромоцитомами/параганглиомами [11]. Примечательно, что у пациентки №22 с акромегалией и феохромоцитомой правого надпочечника мутации в генах SDHA, SDHB, SDHC, SDHD не были обнаружены.

Ни у одного из пациентов с фенокопиями МЭН-1 мы не выявили мутаций в экзонах гена CDKN1B (характерных для синдрома МЭН-4), что подтверждает данные о незначительном вкладе таких мутаций в развитие фенокопий МЭН-1 [2, 19]. У пациентки №9 была выявлена замена в 3’-UTR гена CDKN1Bg.3897G>T (c.*8G>T)), однако ее патологическая значимость не доказана.

Как уже отмечалось, среди АГ у наших пациентов с фенокопиями МЭН-1 преобладали соматотропиномы, что соответствует данным литературы [2]. Сочетание акромегалии и ПГПТ может объясняться и тем, что при акромегалии возрастает частота новообразований (преимущественно щитовидной железы и желудочно-кишечного тракта) [20]. Не исключено, что и ПГПТ может быть обусловлен длительным действием избытка инсулиноподобного фактора роста 1 на околощитовидные железы. Однако данная теория не объясняет возникновение ПГПТ у пациентов с фенокопиями МЭН-1 в сочетании с другими АГ (пролактиномами, кортикотропиномами и ГНАГ). Также необходимо учитывать, что ПГПТ встречается в общей популяции (преимущественно у женщин в постменопаузе) достаточно часто, тогда как частота АГ значительно меньше, а НЭО ПЖ – крайне редки [5, 21]. Тем не менее возможно случайное сочетание двух новообразований у одного пациента. Возможно также существование других генов (в том числе еще не идентифицированных), мутации в которых могут приводить к сочетанию АГ с ПГПТ и/или с НЭО ПЖ.


Мутации в большинстве известных генов, ассоциированных с формированием наследственных и спорадических АГ, не обусловливают развитие фенокопий синдрома МЭН-1. Необходимость прицельного исследования гена AIP у всех пациентов с фенокопиями этого синдрома требует дальнейшего обоснования. Для исключения патологической роли выявленных изменений в генах PTTG2, PRKAR1А, 3’-UTR CDKN1B необходимы исследования с применением молекулярно-биологических методов. Равно необходим поиск новых генов, мутации в которых могли бы быть причиной формирования фенокопий синдрома МЭН-1.

Дополнительная информация


Мы благодарим врачей отделения нейроэндокринологии и остеопатий ФГБУ «Эндокринологический научный центр» Минздрава Росиии за активное участие и помощь в проведении исследования (Ж.Е. Белая, С.Д. Арапова, Т.С. Зенкова, Е.И. Марова).

Информация о финансировании и конфликте интересов.

Работа выполнена при поддержке гранта Президента Российской Федерации № МК-5411.2014.7 «Молекулярно-генетические основы семейных аденом гипофиза».

Участие авторов: концепция и дизайн исследования — Н.Г. Мокрышева, Л.К. Дзеранова, Е.А. Пигарова, Л.Я. Рожинская, А.Н. Тюльпаков; сбор и обработка материала — Е.О. Мамедова, Е.А. Пигарова, Е.Г. Пржиялковская, Е.В. Васильев, В.М. Петров, Н.Н. Молитвословова, Л.К. Дзеранова, Н.Г. Мокрышева; статистическая обработка данных — Е.О. Мамедова, Е.В. Васильев, В.М. Петров; написание текста — Е.О. Мамедова; редактирование — Н.Г. Мокрышева, Е.А. Пигарова, Е.Г. Пржиялковская, Н.Н. Молитвословова, Л.К. Дзеранова, Л.Я. Рожинская, А.Н. Тюльпаков, Г.А. Мельниченко

Список литературы

1. Thakker RV, Newey PJ, Walls GV, et al. Clinical practice guidelines for multiple endocrine neoplasia type 1 (MEN1). J Clin Endocrinol Metab. 2012;97(9):2990-3011. doi: 10.1210/jc.2012-1230

2. Ozawa A, Agarwal SK, Mateo C, et al. The parathyroid/pituitary variant of multiple endocrine neoplasia type 1 usually has causes other than p27Kip1 mutations. J Clin Endocrinol Metab. 2007;92 (5):1948-1951. doi: 10.1210/jc.2006-2563

3. Мамедова Е.О., Мокрышева Н.Г., Пржиялковская Е.Г. и др. Варианты и фенокопии синдрома множественных эндокринных неоплазий 1-го типа. // Терапевтический архив. 2014; Том 86. — № 10. — С. 87-91. [Mamedova EO, Mokrysheva NG, Przhiyalkovskaya EG, et al. Multiple endocrine neoplasia type 1 variants and phenocopies. Terapevticheskii arkhiv. 2014;86(10):87-91. (In Russ.)].

4. Falchetti A, Brandi ML. Multiple endocrine neoplasia type I variants and phenocopies: more than a nosological issue? J Clin Endocrinol Metab. 2009;94(5):1518-1520.doi: 10.1210/jc.2009-0494

5. Turner JJO, Christie PT, Pearce SHS, et al. Diagnostic challenges due to phenocopies: lessons from multiple endocrine neoplasia type1 (MEN1). Hum Mutat. 2010;31(1):E1089-E1101. doi: 10.1002/humu.21170

6. Hai N, Aoki N, Shimatsu A, et al. Clinical features of multiple endocrine neoplasia type 1 (MEN1) phenocopy without germline MEN1 gene mutations: analysis of 20 Japanese sporadic cases with MEN1. Clin Endocrinol. 2010;52(4):509-518. doi: 10.1046/j.1365-2265.2000.00966.x

7. Gadelha MR, Trivellin G, Hernández-Ramírez LC, Korbonits M. Genetics of pituitary adenomas. Front Horm Res. 2013;41:111-140. doi: 10.1159/000345673

8. Wang K, Li M, Hakonarson H. ANNOVAR: functional annotation of genetic variants from high-throughput sequencing data. Nucleic Acids Res. 2010;38(16):e164. doi: 10.1093/nar/gkq603

9. Мамедова Е.О., Пржиялковская Е.Г., Пигарова Е.А., Мокрышева Н.Г., Дзеранова Л.К., Тюльпаков А.Н. Аденомы гипофиза в рамках наследственных синдромов. // Проблемы эндокринологии. 2014. — Том 60. — №4. — С. 51-59. [Mamedova EO, Przhiyalkovskaya EG, Pigarova EA, Mokrysheva NG, Dzeranova LK, Tyul’pakov AN. Pituitary adenomas in the framework of hereditary syndromes.Problemy endokrinologii. 2014;60 (4):51-59. (In Russ.)]. doi: 10.14341/probl201460438-46

10. Далантаева Н.С., Дедов И.И. Генетические и обменные особенности семейных изолированных аденом гипофиза. // Ожирение и метаболизм. 2013. — Т.10. — 2 —. С. 3-10. [Dalantaeva NS, Dedov II. Genetic and metabolic characteristics of familial isolated pituitary adenomas. Ozhirenie i metabolism. 2013;10(2):3-10. (In Russ.)]. doi: 10.14341/2071-8713-4817

11. O’Toole SM, Dénes J, Robledo M, et al. 15 years of paraganglioma: The association of pituitary adenomas and phaechromocytomas or paragangliomas. Endocr Relat Cancer. 2015;22(4):T105-T122. doi: 10.1530/erc-15-0241

12. Панкратова Ю.В., Пржиялковская Е.Г., Пигарова Е.А., Дзеранова Л.К. Фермент сукцинатдегидрогеназа (SDH) и его роль в наследственных аденомах гипофиза. // Ожирение и метаболизм. 2013. — Том 37. — № 4. — С. 10-15. [Pankratova YuV, Przhiyalkovskaya EG, Pigarova EA, Dzeranova LK. The enzyme succinate dehydrogenase (SDH) and its role in hereditary pituitary adenomas.Ozhirenie i metabolism. 2013;10(4):10-15 (In Russ.)]. doi: 10.14341/OMET2013410-15

13. Georgitsi M, Raitila A, Karhu A, et al. Molecular diagnosis of pituitary adenoma predisposition caused by aryl hydrocarbon receptor-interacting protein gene mutations. Proc Natl Acad Sci USA. 2007;104(10):4101-4105. doi: 10.1073/pnas.0700004104

14. Belar O, De La Hoz C, Pérez-Nanclares G, et al. Novel mutations in MEN1, CDKN1B and AIP genes in patients with multiple endocrine neoplasia type 1 syndrome in Spain. Clin Endocrinol. 2012;76:719-724. doi: 10.1111/j.1365-2265.2011.04269.x

15. Pardi E, Marcocci C, Borsari S, et al. Aryl hydrocarbon receptor intercting protein (AIP) mutations occur rarely in sporadic parathyroid adenomas. J Clin Endocrinol Metab. 2013;98(7):2800-2810. doi: 10.1210/jc.2012-4029

16. Mete O, Ezzat S, Asa SL. Biomarkers of aggressive pituitary adenomas. J Mol Endocrinol. 2012 49(2) R69-R78. doi: 10.1530/JME-12-0113

17. [Internet]. The Human Gene Mutation Database of the Institute of Medical Genetics in Cardiff. Available from:

18. Montani M, Schmitt AM, Schmid S, et al. No mutations but an increased frequency of SDHx polymorphisms in patients with sporadic and familial medullary thyroid carcinoma. Endocr Relat Cancer. 2005;12(4):1011-1016. doi: 10.1677/erc.1.00996

19. Agarwal SK, Mateo CM, Marx SJ. Rare germline mutations in cyclin-dependent kinase inhibitor genes in multiple endocrine neoplasia type 1 and related states. J Clin Endocrinol Metab. 2009;94(5):1826-1834. doi: 10.1210/jc.2008-2083

20. Melmed S, Casanueva FF, Klibanski A, et al. A consensus on the diagnosis and treatment of acromegaly complications. Pituitary. 2013;16(3):294-302. doi: 10.1007/s11102-012-0420-x

21. Мокрышева Н.Г., Рожинская Л.Я., Перетокина Е.В. и др. Анализ основных эпидемиологических характеристик первичного гиперпаратиреоза в России (по данным регистра). // Проблемы эндокринологии. – 2012. – Т.58 – №5 – С. 16-20. [Mokrysheva NG, Rozhinskaya LYa, Peretokina EV, et al. The results of analysis of the major epidemiological characteristics of primary hyperparathyroidism inRussia based on the registry data. Probl endocrin (Mosk). 2012;58(5):16-20. (In Russ.)]. doi: 10.14341/probl201558516020

Об авторах

Елизавета Октаевна Мамедова
ФГБУ "Эндокринологический научный центр" Минздрава России
аспирант отд. нейроэндокринологии и остеопатий
Конфликт интересов: Конфликт интересов отсутствует

Наталья Георгиевна Мокрышева
ФГБУ "Эндокринологический научный центр" Минздрава России

д.м.н., рук. Центра гиперпаратиреоза

Конфликт интересов: Конфликт интересов отсутствует

Екатерина Александровна Пигарова
ФГБУ "Эндокринологический научный центр" Минздрава России

к.м.н., вед.н.с. отд. нейроэндокринологии и остеопатий

Конфликт интересов: Конфликт интересов отсутствует

Елена Георгиевна Пржиялковская
ФГБУ "Эндокринологический научный центр" Минздрава России

к.м.н., ст.н.с. отд. нейроэндокринологии и остеопатий

Конфликт интересов: Конфликт интересов отсутствует

Евгений Витальевич Васильев
ФГБУ "Эндокринологический научный центр" Минздрава России

к.б.н., ст.н.с. отд. наследственных эндокринопатий

Конфликт интересов: Конфликт интересов отсутствует

Василий Михайлович Петров
ФГБУ "Эндокринологический научный центр" Минздрава России

к.х.н., ст.н.с. отд. наследственных эндокринопатий

Конфликт интересов: Конфликт интересов отсутствует

Лариса Константиновна Дзеранова
ФГБУ "Эндокринологический научный центр" Минздрава России

д.м.н., гл.н.с. отд. нейроэндокринологии и остеопатий

Конфликт интересов: Конфликт интересов отсутствует

Наталья Николаевна Молитвословова
ФГБУ "Эндокринологический научный центр" Минздрава России

д.м.н., гл.н.с. отд. нейроэндокринологии и остеопатий

Конфликт интересов: Конфликт интересов отсутствует

Людмила Яковлевна Рожинская
ФГБУ "Эндокринологический научный центр" Минздрава России

д.м.н, проф., гл.н.с. отд. нейроэндокринологии и остеопатий

Конфликт интересов: Конфликт интересов отсутствует

Анатолий Николаевич Тюльпаков
ФГБУ "Эндокринологический научный центр" Минздрава России

д.м.н., зав. отд. наследственных эндокринопатий

Конфликт интересов: Конфликт интересов отсутствует

Галина Афанасьевна Мельниченко
ФГБУ "Эндокринологический научный центр" Минздрава России

академик РАН, директор Института клинической эндокринологии

Конфликт интересов: Конфликт интересов отсутствует

Дополнительные файлы


Для цитирования:

Мамедова Е.О., Мокрышева Н.Г., Пигарова Е.А., Пржиялковская Е.Г., Васильев Е.В., Петров В.М., Дзеранова Л.К., Молитвословова Н.Н., Рожинская Л.Я., Тюльпаков А.Н., Мельниченко Г.А. Фенокопии синдрома множественных эндокринных неоплазий 1 типа: роль генов, ассоциированных с развитием аденом гипофиза. Проблемы Эндокринологии. 2016;62(4):4-10.

For citation:

Mamedova E.O., Mokrysheva N.G., Pigarova E.A., Przhiyalkovskaya E.G., Vasilyev E.V., Petrov V.M., Dzeranova L.K., Molitvoslovova N.N., Rozhinskaya L.Y., Tiulpakov A.N., Melnichenko G.A. Phenocopies of multiple endocrine neoplasia type 1: role of the genes, associated with the development of pituitary adenomas. Problems of Endocrinology. 2016;62(4):4-10. (In Russ.)

Просмотров: 298

ISSN 0375-9660 (Print)
ISSN 2308-1430 (Online)